Homologus & Analogus

1. A) The Whale and the Human possess a Homologous trait, this trait is the fin bones of the whale and the arm bones of the human.

    B) They both have a large upper arm bone, a lower part of the limb is made up of two bones, a large bone on one side and a small bone on the other side. Both have similar smaller bones in the "wrist" area. The use of the whale fin is completely different from humans, their function of the fin is used to swim solely. The human arm and hand is used for a multitude of things; such as, picking things up, grabbing, swings, holding, etc.. The structure of both are very similar if you look at pictures below.
 
  C) The common ancestor for these two species are the Chimpanzee, I know they both have the same
 bones in the slightly same structure and also I researched it finding it true.

   


















2. A) Insects and Vertebrates (Humans) both possess Analogous trait of the legs because they evolved with same traits for environment, but did not inherit it through common ancestor.

    B) Both these species use this trait to climb, jump, walk, attack, and protect etc.. The structure of the species are also similar, though not exact both have an upper and lower part of the leg that bends.
 
 C) The last common ancestor of these two species is a legless worm, but this species does not possess the analogous trait that the other two species possess.

                                                             Vertebrate(Human)
 Insect

DNA MOLECULE: DECODE ME :)

My DNA strand code is as shown below, please decode my code according to chart that you have:

CACCGTTACTAAGTTATAATTCTATGGTTAAAATTGTCTAATCACGACCTTATCTCTTCC

DARWIN'S WORLD

Jean-Baptiste Lamarck was very influential in darwin's theory of natural selection. Lamarck studied the invertebrates and was the first of his time to really study this. His studied allowed him to see that there was an inheritance of acquired traits, the idea of heredity. Though Lamarck, had these great ideas, he never was credited until after his death. Lamarck helped add to Darwin's theory, through the idea that traits could only evolve if they were heretiable. Lamarck saw that insects and worms had traits that could pass onto further generations, but Darwin took that idea and expanded on it making it creditable. Lamarck had a very positive effect on Darwin's theory, helping him build on Lamarck's idea, if it was not for Lamarck I dont think Darwin could fully ever discover his theory correct. This is because Lamarck got people to start looking at the changes of organic and inorganic, if it wasn't for him, Darwin would have never even looked at the possibilities of there being any change. The attitude of the church on Darwin's finding was very shunned, the church found anything out of line of religious and biblical writings against them. So when Darwin published his book, On the origin of species, people were reluctant to actually pursue his ideas or further look into it. People were scared to agree with it because they did not want the church to punish them.