1. Heat, an environmental stress, negatively impacts the survival of humans by disturbing homeostasis because if the heat gets to extreme it could change our core body temperature and ultimately kill us.
2. A short term adaption of heat is sweating. Humans sweat because it cools the body down when it is hot.
A facultative adaption of heat is the body lowers core temperature. The human body tries to cool body by lowering temperatures.
A development adaption of heat is people in areas where heat is more extreme they have blonde hair and also are usually skinner and slender.
A Cultural adaption is that we built portable face misters that keep your body cool.
3. The benefit could be that it shows how we react in certain conditions and can see why our bodies are doing this. Yes, it would tell us what is going on and why our bodies are doing those things. One way to use info could be to predict that we need to make sure our bodies are protected in case it gets very cold or very hot.
4. You could use race to show how in that race they have this trait because it is needed to protect from heat for example. I think its better because the human race is all the same we need to look at traits because of environment not race.
Anthropology World
Tuesday, July 31, 2012
Tuesday, July 24, 2012
Hear No Evil...
The use of language is key in society today, without language we would not be able to communicate as well as we do. Speech is a key to the way our society functions, without it we would not be as advanced. In this experiment, I explored language in two parts, each with a different limitation.
In the first part, I engaged in conversation for 15 minutes where I was not allowed to use any version of a symbolic language. I found this experiment difficult because not being able to speak, write, or is ASL make you have to think of other ways to communicate. When I performed this experiment I could not figure out how to actually relay what I wanted to say without using speech. They were never really sure what I was saying. I found the best way to relay something was to just act it out. They thought it was funny to mess with me, but they thought it was cool and learned the importance of symbolic language. They did change the way they communicated with me by asking a lot of questions to make sure they understood what I was doing. It was very hard to do these things. I think the speaking culture has advantage in communicating complex ideas because they can better describe things through a vocabulary. The speaking culture would probably become very annoyed with non-symbolic language culture because of the barrier between communication. Making the environment around them very hostile because they do not understand one another. The spanish speaking culture has a hard time in America with communicating with others, native of that community. When there is a language barrier, it is very hard to figure out the problem. So it cam turn to violence because they do not understand each other. We have lots of signs that are in both languages to stop things like this from happening. Also, there are translators to break this barrier between people. Symbolic Language is a huge part of communication in todays' society.
In the second part of the experiment, I engaged in conversation for 15 minutes where I could not use non-verbal communication, such as, moving hands, raising eyebrows, smiling,etc.. I was not able to last the full 15 minutes because I started to laugh and smile. I thought it was funny and I would start to use my hands without knowing. It was hard because I was so mono tone and had no expression, which made me laugh at the sound. Also, my subjects were making expressions and moving around causing me to want to move my hands as I speak. When I speak I use my hands a lot, so keeping them in place is hard. My partners were affected by my limitations because it made them kind of laugh at the way I just stayed still with no movement. They thought it was awkward talking to someone that just talked like a robot that did not move. This experiment shows just how important non-verbal communication is in the world. I know we communicate more through the non-verbal than the verbal. This type of communication is very important in the way we communicate because we show most of our emotions through the non-verbal. Yes, in different cultures body language can mean something totally different and change what they are meaning to say. The adaptive benefit of knowing how to read body language is to be able to understand another person, see what they might be thinking of doing. I do not really see where not being able to read body language could beneficial in any environment.
In society, language plays a huge part in the way we communicate with one another. People communicate in more ways then just speech, and this experiment shows just how important non-verbal language is to society. Overall, society needs language and non-verbal language to communicate effectively.
In the first part, I engaged in conversation for 15 minutes where I was not allowed to use any version of a symbolic language. I found this experiment difficult because not being able to speak, write, or is ASL make you have to think of other ways to communicate. When I performed this experiment I could not figure out how to actually relay what I wanted to say without using speech. They were never really sure what I was saying. I found the best way to relay something was to just act it out. They thought it was funny to mess with me, but they thought it was cool and learned the importance of symbolic language. They did change the way they communicated with me by asking a lot of questions to make sure they understood what I was doing. It was very hard to do these things. I think the speaking culture has advantage in communicating complex ideas because they can better describe things through a vocabulary. The speaking culture would probably become very annoyed with non-symbolic language culture because of the barrier between communication. Making the environment around them very hostile because they do not understand one another. The spanish speaking culture has a hard time in America with communicating with others, native of that community. When there is a language barrier, it is very hard to figure out the problem. So it cam turn to violence because they do not understand each other. We have lots of signs that are in both languages to stop things like this from happening. Also, there are translators to break this barrier between people. Symbolic Language is a huge part of communication in todays' society.
In the second part of the experiment, I engaged in conversation for 15 minutes where I could not use non-verbal communication, such as, moving hands, raising eyebrows, smiling,etc.. I was not able to last the full 15 minutes because I started to laugh and smile. I thought it was funny and I would start to use my hands without knowing. It was hard because I was so mono tone and had no expression, which made me laugh at the sound. Also, my subjects were making expressions and moving around causing me to want to move my hands as I speak. When I speak I use my hands a lot, so keeping them in place is hard. My partners were affected by my limitations because it made them kind of laugh at the way I just stayed still with no movement. They thought it was awkward talking to someone that just talked like a robot that did not move. This experiment shows just how important non-verbal communication is in the world. I know we communicate more through the non-verbal than the verbal. This type of communication is very important in the way we communicate because we show most of our emotions through the non-verbal. Yes, in different cultures body language can mean something totally different and change what they are meaning to say. The adaptive benefit of knowing how to read body language is to be able to understand another person, see what they might be thinking of doing. I do not really see where not being able to read body language could beneficial in any environment.
In society, language plays a huge part in the way we communicate with one another. People communicate in more ways then just speech, and this experiment shows just how important non-verbal language is to society. Overall, society needs language and non-verbal language to communicate effectively.
Tuesday, July 10, 2012
Hoax of the Century!!
In the 1900's scientist around the world were fooled by a team of archaeologist, for more than forty years. In 1912, in louis, in a little village called, Piltdown, a man named, Charles Dawson, found something that would change the way evolution was looked at for forty years. This something was a piece of a skull, said to be of an ancient human. Two other men, Arthur Woodward and Father Pierre Tehard, were hired to the team to excavate. This three men, found all kinds of fossils that completed an skull of a ancient human. The discovers would help one scientist prove his ideas that the human, "Big Brain" came before we could walk on two legs, which today, we know is not true.We walked on our legs before we had bigger brains. These men said, they found a skull that would be millions of years old, changing a lot of things in evolutionary findings. This would soon be proved wrong, almost forty years later.
The Hoax was first starting to look fishy, when fossils of ancient humans much younger than its piltdown counterpart, were being found in different countries. The odd part was these newer skulls that were only hundereds of hundreds of years old didn't have the development of bone structure the piltdown skull had. Then the invention that cracked the egg, a process called, Flourine dating. The process works because bones are primarily made up of calcium hydroxy apatite. The bone is exposed to water mixed with flouride and soaked. To measure it you use a Flouride Selective Ion. When ion is placed in water, it produces a volt proportional to amount of flouride in solution. The calibration curve give you a rough date that fossil is from. When they used this process to figure that the skull was no more than a couple 100 years old. Further investigation showed that the teeth was filed down, that the jaw bone was from an ape. The scientific community was devastated when, they found out that the skull was really a hoax. They thought that no scientist, a gentlemen of scholarly honor, would ever do something so immoral. Scientist were astonished and outraged that they would lie about such a thing, from that day forward, the science community would have to make sure everything published was a verifiable source. This was a mistake that shook the scientific community to their core.
The cause of this terrible hoax was something we call the human factor, the idea that humans make mistakes and do wrong things to gain more for themselves. I believe that if the human factor could be removed and all processes be error-free would be a somewhat bad thing, I would not want it to happen. This idea scares me because it is already happening today,with assembly lines. If this happened humans would no longer need to think or do anything. This would cause a world of idioticy, and when machines failed humans as a race would die. In this hoax, it has a very good life lesson, don't trust an unverified source. Trusting an unverified source could make you look bad, have you make terrible mistakes, or cause another person to cause terrible mistakes. They say don't trust the internet because it is an unverified source, this is true, unless you make sure you find trustworthy sources only. People believed these scientist because of their honor and scholarly education but, in the end the truth must always be challenged because if you don't this might happen over and over again.
The Hoax was first starting to look fishy, when fossils of ancient humans much younger than its piltdown counterpart, were being found in different countries. The odd part was these newer skulls that were only hundereds of hundreds of years old didn't have the development of bone structure the piltdown skull had. Then the invention that cracked the egg, a process called, Flourine dating. The process works because bones are primarily made up of calcium hydroxy apatite. The bone is exposed to water mixed with flouride and soaked. To measure it you use a Flouride Selective Ion. When ion is placed in water, it produces a volt proportional to amount of flouride in solution. The calibration curve give you a rough date that fossil is from. When they used this process to figure that the skull was no more than a couple 100 years old. Further investigation showed that the teeth was filed down, that the jaw bone was from an ape. The scientific community was devastated when, they found out that the skull was really a hoax. They thought that no scientist, a gentlemen of scholarly honor, would ever do something so immoral. Scientist were astonished and outraged that they would lie about such a thing, from that day forward, the science community would have to make sure everything published was a verifiable source. This was a mistake that shook the scientific community to their core.
The cause of this terrible hoax was something we call the human factor, the idea that humans make mistakes and do wrong things to gain more for themselves. I believe that if the human factor could be removed and all processes be error-free would be a somewhat bad thing, I would not want it to happen. This idea scares me because it is already happening today,with assembly lines. If this happened humans would no longer need to think or do anything. This would cause a world of idioticy, and when machines failed humans as a race would die. In this hoax, it has a very good life lesson, don't trust an unverified source. Trusting an unverified source could make you look bad, have you make terrible mistakes, or cause another person to cause terrible mistakes. They say don't trust the internet because it is an unverified source, this is true, unless you make sure you find trustworthy sources only. People believed these scientist because of their honor and scholarly education but, in the end the truth must always be challenged because if you don't this might happen over and over again.
-Austin Gibbons
Thursday, July 5, 2012
Primates gone wild
Lemurs
a) They live in a habitat that consist of tree living, also known as arboreal. These animals mainly live in trees and only go down once in a while for food.
b) The diet of the lemur is fruit, leaves, plant material, and sometimes insects. These animals have to eat off things that live in the rain forest.
c) I believe this diet shows that the animal has adapted to there way of life in trees because they eat small fruits and other things found in that habitat.
Spider Monkey
a) This animal living quarters consist in the tropical rainforest mainly from Mexico down to boliva and Brazil. They need lots of trees and water in their environment.
b) Their diet consist of 90% fruit and nuts, also some bugs and insects.
c) This shows that the animal has adapted to their environment because they eat mostly fruit and nuts, which is rich in those areas.
Baboon
a) Baboons live in east africa and uganda, you can find them in tall trees near water or cliff faces.
b) Their diet consist of mostly grass, also berries, seeds, pods, blossoms, insects, and small quantities of meat, such as fish.
c) This shows they have adpated because they are starting to eat meat as fruits are more scares and they find a new source of food in their water source.
Gibbon
a) They are usually found in lowland dipterocap forest, also in rain forest.
b) Their diet consist of fruit, figs, small sweet fruit, insects, wasps, and bird eggs.
c) I think they adapted to their environment because they are eating sources of food that are not scare in these areas and maintain life.
Chimpanzee
a) Chimpanzees are found in rainforest and savannahs of Africa.
b) They eat a variety of meats and plants, they eat different types of food depending on their habitat.
c) The sentence above proves chimpanzees have adapted to their environment because their diet changes with the area they are in, if they are scare of fruit they will eat another animal!
I think that the environment has huge effects on an animals physical and behavioral traits. This blog shows that all these primates eat fruits and mostly plants to survive in their environments and almost all of them are in the same habitats. The environment plays a huge roll in everything any living organism does, they need to be strong to survive and without adaptation to that environment they will not survive.
a) They live in a habitat that consist of tree living, also known as arboreal. These animals mainly live in trees and only go down once in a while for food.
b) The diet of the lemur is fruit, leaves, plant material, and sometimes insects. These animals have to eat off things that live in the rain forest.
c) I believe this diet shows that the animal has adapted to there way of life in trees because they eat small fruits and other things found in that habitat.
Spider Monkey
a) This animal living quarters consist in the tropical rainforest mainly from Mexico down to boliva and Brazil. They need lots of trees and water in their environment.
b) Their diet consist of 90% fruit and nuts, also some bugs and insects.
c) This shows that the animal has adapted to their environment because they eat mostly fruit and nuts, which is rich in those areas.
Baboon
a) Baboons live in east africa and uganda, you can find them in tall trees near water or cliff faces.
b) Their diet consist of mostly grass, also berries, seeds, pods, blossoms, insects, and small quantities of meat, such as fish.
c) This shows they have adpated because they are starting to eat meat as fruits are more scares and they find a new source of food in their water source.
Gibbon
a) They are usually found in lowland dipterocap forest, also in rain forest.
b) Their diet consist of fruit, figs, small sweet fruit, insects, wasps, and bird eggs.
c) I think they adapted to their environment because they are eating sources of food that are not scare in these areas and maintain life.
Chimpanzee
a) Chimpanzees are found in rainforest and savannahs of Africa.
b) They eat a variety of meats and plants, they eat different types of food depending on their habitat.
c) The sentence above proves chimpanzees have adapted to their environment because their diet changes with the area they are in, if they are scare of fruit they will eat another animal!
I think that the environment has huge effects on an animals physical and behavioral traits. This blog shows that all these primates eat fruits and mostly plants to survive in their environments and almost all of them are in the same habitats. The environment plays a huge roll in everything any living organism does, they need to be strong to survive and without adaptation to that environment they will not survive.
Friday, June 29, 2012
Homologus & Analogus
1. A) The Whale and the Human possess a Homologous trait, this trait is the fin bones of the whale and the arm bones of the human.
B) They both have a large upper arm bone, a lower part of the limb is made up of two bones, a large bone on one side and a small bone on the other side. Both have similar smaller bones in the "wrist" area. The use of the whale fin is completely different from humans, their function of the fin is used to swim solely. The human arm and hand is used for a multitude of things; such as, picking things up, grabbing, swings, holding, etc.. The structure of both are very similar if you look at pictures below.
C) The common ancestor for these two species are the Chimpanzee, I know they both have the same
bones in the slightly same structure and also I researched it finding it true.

2. A) Insects and Vertebrates (Humans) both possess Analogous trait of the legs because they evolved with same traits for environment, but did not inherit it through common ancestor.
B) Both these species use this trait to climb, jump, walk, attack, and protect etc.. The structure of the species are also similar, though not exact both have an upper and lower part of the leg that bends.
C) The last common ancestor of these two species is a legless worm, but this species does not possess the analogous trait that the other two species possess.
Vertebrate(Human)
Insect
B) They both have a large upper arm bone, a lower part of the limb is made up of two bones, a large bone on one side and a small bone on the other side. Both have similar smaller bones in the "wrist" area. The use of the whale fin is completely different from humans, their function of the fin is used to swim solely. The human arm and hand is used for a multitude of things; such as, picking things up, grabbing, swings, holding, etc.. The structure of both are very similar if you look at pictures below.
C) The common ancestor for these two species are the Chimpanzee, I know they both have the same
bones in the slightly same structure and also I researched it finding it true.

2. A) Insects and Vertebrates (Humans) both possess Analogous trait of the legs because they evolved with same traits for environment, but did not inherit it through common ancestor.
B) Both these species use this trait to climb, jump, walk, attack, and protect etc.. The structure of the species are also similar, though not exact both have an upper and lower part of the leg that bends.
C) The last common ancestor of these two species is a legless worm, but this species does not possess the analogous trait that the other two species possess.
Vertebrate(Human)
Insect
Thursday, June 21, 2012
DNA MOLECULE: DECODE ME :)
My DNA strand code is as shown below, please decode my code according to chart that you have:
CACCGTTACTAAGTTATAATTCTATGGTTAAAATTGTCTAATCACGACCTTATCTCTTCC
CACCGTTACTAAGTTATAATTCTATGGTTAAAATTGTCTAATCACGACCTTATCTCTTCC
Thursday, June 14, 2012
DARWIN'S WORLD
Jean-Baptiste Lamarck was very influential in darwin's theory of natural selection. Lamarck studied the invertebrates and was the first of his time to really study this. His studied allowed him to see that there was an inheritance of acquired traits, the idea of heredity. Though Lamarck, had these great ideas, he never was credited until after his death. Lamarck helped add to Darwin's theory, through the idea that traits could only evolve if they were heretiable. Lamarck saw that insects and worms had traits that could pass onto further generations, but Darwin took that idea and expanded on it making it creditable. Lamarck had a very positive effect on Darwin's theory, helping him build on Lamarck's idea, if it was not for Lamarck I dont think Darwin could fully ever discover his theory correct. This is because Lamarck got people to start looking at the changes of organic and inorganic, if it wasn't for him, Darwin would have never even looked at the possibilities of there being any change. The attitude of the church on Darwin's finding was very shunned, the church found anything out of line of religious and biblical writings against them. So when Darwin published his book, On the origin of species, people were reluctant to actually pursue his ideas or further look into it. People were scared to agree with it because they did not want the church to punish them.
Subscribe to:
Posts (Atom)

